View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2446_low_10 (Length: 233)
Name: NF2446_low_10
Description: NF2446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2446_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 15 - 215
Target Start/End: Complemental strand, 45525659 - 45525459
Alignment:
| Q |
15 |
aatattatatatgttggggctgaggtttgaatcccaattttccatttctccacgtataatatgattgaatcttattacaaaatagttctttctgaataaa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45525659 |
aatattatatatgttggggctgaggtttgaatcccaattttctatttctcaacgtataatatgattgaatcttattacaaaatagttctttctgaataaa |
45525560 |
T |
|
| Q |
115 |
ataagaagaacacacttgtaatttatacatgatatggttgacttatgaatatacgtaaaccgatcaatccccacgagaatctcccattttcaatgtggaa |
214 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45525559 |
ataagaagaacacacttgtaacttatacatgatatggttgacttatgaatatacgtaaagtgatcaatccccacgagaatctcccattttcaatgtggaa |
45525460 |
T |
|
| Q |
215 |
c |
215 |
Q |
| |
|
| |
|
|
| T |
45525459 |
c |
45525459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University