View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2446_low_5 (Length: 295)
Name: NF2446_low_5
Description: NF2446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2446_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 263; Significance: 1e-147; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 11 - 277
Target Start/End: Complemental strand, 45916888 - 45916622
Alignment:
| Q |
11 |
cagagagtgagaatattgcatgatgcatctagaaaacacacctacttttcatggctttcacatgcctgcagaatgggaacctcactcacagtgttggatt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45916888 |
cagagagtgagaatattgcatgatgcatctagaaaacacacctacttttcatggctttcacatgcctgcagaatgggaacctcactcacagtgttggatt |
45916789 |
T |
|
| Q |
111 |
ggttggcccgtaagtatttttatttacttcgcacatactccatgcttcttctcttgttctgttatgatgatttagcctcatgttgttgcgtgaaaggaac |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45916788 |
ggttggcccgtaagtatttttatttacttcgcacatactccatgcttcttctcttgttctgttatgatgatttagcttcatgttgttgcgtgaaaggaac |
45916689 |
T |
|
| Q |
211 |
gtgccgataattggcgtgacggtgccgttcatgctcaacttgtgtttaccagggtggcggctgcaat |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45916688 |
gtgccgataattggcgtgacggtgccgttcatgctcaacttgtgtttaccagggtggcggctgcaat |
45916622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 59 - 127
Target Start/End: Complemental strand, 45910110 - 45910042
Alignment:
| Q |
59 |
tcatggctttcacatgcctgcagaatgggaacctcactcacagtgttggattggttggcccgtaagtat |
127 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| ||||||||||| ||||| ||||||||||| |
|
|
| T |
45910110 |
tcatggctttcacatgccttcagaatgggaacctcactctcagtgttggatgggttgtcccgtaagtat |
45910042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 191 - 267
Target Start/End: Complemental strand, 45909983 - 45909907
Alignment:
| Q |
191 |
tgttgttgcgtgaaaggaacgtgccgataattggcgtgacggtgccgttcatgctcaacttgtgtttaccagggtgg |
267 |
Q |
| |
|
|||||||||| || ||||||| | ||||||||||||||| ||||||||||||||||| ||| ||| ||||||||| |
|
|
| T |
45909983 |
tgttgttgcgggataggaacgcactgataattggcgtgacaatgccgttcatgctcaacgtgtttttgccagggtgg |
45909907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University