View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2446_low_7 (Length: 249)
Name: NF2446_low_7
Description: NF2446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2446_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 5e-68; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 1 - 175
Target Start/End: Complemental strand, 27301902 - 27301729
Alignment:
| Q |
1 |
caatttgaaaagcccacaatgaatatgtattagtatatgtgatagcattactttataaaaatactaacaaacgtctttataaaatttgataagaaattta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
27301902 |
caatttgaaaagcccacaatgaatatgtattagtatatgtgataacattactttataaaaatactaacaaacgtctttataaaacttgataagaaattta |
27301803 |
T |
 |
| Q |
101 |
aaaataaattttgtatgttcaacacattaaaacatcaaaaataannnnnnnnatataaaagttatcgattgttta |
175 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
27301802 |
aaaataaa-tttgtatgttcaacacattaaaacatcaaaaataattttttctatataaaaattatcgattgttta |
27301729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 173 - 240
Target Start/End: Complemental strand, 27300996 - 27300929
Alignment:
| Q |
173 |
ttatcaacacacttactttattgatgcatttttattctttaagctaggcatctagtgcttcatgatga |
240 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
27300996 |
ttatcaagacacttactttattgatgcatttttattttttaagctaggcatctagtgcttcatgatga |
27300929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University