View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2446_low_8 (Length: 246)
Name: NF2446_low_8
Description: NF2446
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2446_low_8 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 17 - 246
Target Start/End: Original strand, 28769811 - 28770040
Alignment:
| Q |
17 |
cactaagcatttttctttctactatattccctatttccagcgtttattttgccgacattatgctccaactgattgaatttcataattctatgcaggtagt |
116 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28769811 |
cactaagcatttttcttactactatattccctatttccagcgtttattttgccgacattatgctccaactgattgaatttcataattctatgcaggtagt |
28769910 |
T |
|
| Q |
117 |
ccgcacatgtactcgtacatgcttgcacagaggaagaaagccctcgccaaagcaaaggccgcttagttaaacatcattagtagtttccatcgtagttagt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
28769911 |
ccgcacatgtactcgtacatgcttgcacagaggaagaaagccctcgccaaagcaaaggccgcttagttaaacatcattagtagttttcattgtagttagt |
28770010 |
T |
|
| Q |
217 |
agtcattaccactagcagaaatttcagcct |
246 |
Q |
| |
|
||||||||||||| |||||||||||||||| |
|
|
| T |
28770011 |
agtcattaccactggcagaaatttcagcct |
28770040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University