View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2449_high_2 (Length: 407)
Name: NF2449_high_2
Description: NF2449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2449_high_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 128; Significance: 5e-66; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 128; E-Value: 5e-66
Query Start/End: Original strand, 244 - 379
Target Start/End: Original strand, 45076940 - 45077075
Alignment:
| Q |
244 |
gaagaaaattttattgaaatactaacaagtatttaaatgtccatcttatttaacttttgataaaattgtgcagcttggattaaaatttaaatgttaagct |
343 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45076940 |
gaagaaagttttattgaaatactaacaagtatttaaatgtccatcttatttaacttttgacaaaattgtgcagcttggattaaaatttaaatgttaagct |
45077039 |
T |
 |
| Q |
344 |
ttgtgaatcataaaattagaagaaaataaatcaaga |
379 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
45077040 |
ttgtgaatcataaaattagaagaaaataaatcaaga |
45077075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 18 - 143
Target Start/End: Original strand, 45076714 - 45076839
Alignment:
| Q |
18 |
acaaaatgcatatcaaaatcaaatcaaaagttattattatttggctatacaatttttcctatggttaatgttgattcattgtaaagagaaaagtaataaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
45076714 |
acaaaatgcatatcaaaatcaaatcaaaagttattattatttggctatacaatttttcctatggttaattttgattcattgtaaagagaaaagtaataaa |
45076813 |
T |
 |
| Q |
118 |
ggtaattcaattttttactttatgcc |
143 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
45076814 |
ggtaattcaattttttactttatgcc |
45076839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University