View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2449_low_13 (Length: 236)
Name: NF2449_low_13
Description: NF2449
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2449_low_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 8896940 - 8897160
Alignment:
| Q |
1 |
actatgactatagcgcctaccatcactagaagttcttgaattcttagtaaccgcatttgaaataacctctccaacattgccacaactattaatatgattt |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
8896940 |
actatgattatagcgcctaccatcactagaagttcttgaattcttagtaaccgcatttgaaatagcctctccaacattgccacgactattaatatgattt |
8897039 |
T |
|
| Q |
101 |
gaagcatgacaaaagtcattgccaaaaccctgaccagcactaggagaatcatgcactgcatgatccaaatcagnnnnnnnagcaaggttttggttgtgaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
8897040 |
gaagcatgacaaaagtcattgccaaaaccctgaccagcactaggagaatcatgcactgcatgatccaaatcagttttttcagtaaggttttggttgtgaa |
8897139 |
T |
|
| Q |
201 |
aactgtagttagcgtcataac |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
8897140 |
aactgtagttagcgtcataac |
8897160 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University