View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2450_high_6 (Length: 236)
Name: NF2450_high_6
Description: NF2450
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2450_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 13 - 220
Target Start/End: Original strand, 46748310 - 46748507
Alignment:
| Q |
13 |
agcataggaagattttgtcccttacataggaaagtggcgttatgctggggctaccctttttggtggctgctgtaggaccactcccaaaactattagaggc |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46748310 |
agcagaggaagattttgtcccttacataggaaagtggcgttatgctggggctaccctttttggtggctgctgtaggaccactcccaaaactattagaggc |
46748409 |
T |
 |
| Q |
113 |
ataaccgaggcattatatggaaagcctcatggcaaatgtgtataaaatgttgattgatgttgaagtatggtttatcttatgtgtgtaataattaatgatg |
212 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46748410 |
ataaccgaggcattatatggaaaacctcatggcaaatgtatataaa----------ctgttgaagtatggtttatcttatgtgtgtaataattaatgatg |
46748499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University