View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2451_high_5 (Length: 305)
Name: NF2451_high_5
Description: NF2451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2451_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 6e-68; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 162 - 296
Target Start/End: Complemental strand, 35725949 - 35725815
Alignment:
| Q |
162 |
aattagtagttaaattaatagtgacaacaaaatattttgaggaacaaaacaagcagaaaggttacacgtcgaaatttgatgttttctcttgttatctagt |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35725949 |
aattagtagttaaattaatagtgacaacaaaatattttgaggaacaaaacaagcagaaaggttacacgtcgaaatttgatgttttctcttgttatctagt |
35725850 |
T |
 |
| Q |
262 |
cattattgatgtgtcatgtttgtgatgttgatgat |
296 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
35725849 |
cattcttgatgtgtcatgtttgtgatgttgatgat |
35725815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University