View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2451_low_8 (Length: 249)
Name: NF2451_low_8
Description: NF2451
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2451_low_8 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 2 - 249
Target Start/End: Original strand, 40979182 - 40979427
Alignment:
| Q |
2 |
caccaccataccatagcactttccactaccattgcctctcatccatcctcaccggatatatcacnnnnnnnnaaatagtagtagtaactttttcattaaa |
101 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||| |||| | | |
|
|
| T |
40979182 |
caccaccataccagagcactttccactaccattgcctctcatccatcctcatcggatatatcacttttttttaaatagtagtagtaacttattcaatgga |
40979281 |
T |
|
| Q |
102 |
tgagtgtattttatataacatactagtatatatattaagattctcaattttgtagtgcttgtacaaaggaaggtgtggtgagatcatgcatgtgaattcg |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40979282 |
tgagtgtattttatataacatactagtata--tattaagattctcaattttgtagtgcttgtacaaaggaaggtgtggtgagatcatgcatgtgaattcg |
40979379 |
T |
|
| Q |
202 |
tttgaaatcttgcatttgtgagtatccaataatgttttttcttccctt |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40979380 |
tttgaaatcttgcatttgtgagtatccaataatgttttttcttccctt |
40979427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 4 - 52
Target Start/End: Complemental strand, 8938877 - 8938829
Alignment:
| Q |
4 |
ccaccataccatagcactttccactaccattgcctctcatccatcctca |
52 |
Q |
| |
|
||||| ||||| |||||||||| | |||||||||||||||||||||||| |
|
|
| T |
8938877 |
ccaccgtaccagagcactttccgccaccattgcctctcatccatcctca |
8938829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 4 - 64
Target Start/End: Original strand, 19919190 - 19919250
Alignment:
| Q |
4 |
ccaccataccatagcactttccactaccattgcctctcatccatcctcaccggatatatca |
64 |
Q |
| |
|
|||||||||| ||||||||| | ||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
19919190 |
ccaccataccggagcactttctgccaccattgcctctcatccattctcaccggacatatca |
19919250 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 16 - 57
Target Start/End: Complemental strand, 5859755 - 5859714
Alignment:
| Q |
16 |
agcactttccactaccattgcctctcatccatcctcaccgga |
57 |
Q |
| |
|
|||||||||||| ||| ||||| ||||||||||||||||||| |
|
|
| T |
5859755 |
agcactttccaccaccgttgccactcatccatcctcaccgga |
5859714 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 33 - 65
Target Start/End: Original strand, 33101660 - 33101692
Alignment:
| Q |
33 |
ttgcctctcatccatcctcaccggatatatcac |
65 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
33101660 |
ttgcctctcatccatcctcaccggataaatcac |
33101692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University