View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2452_low_20 (Length: 250)
Name: NF2452_low_20
Description: NF2452
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2452_low_20 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 11 - 250
Target Start/End: Complemental strand, 2488305 - 2488055
Alignment:
| Q |
11 |
cataggtagcattagaactgtgtggaacatgaactcagtaagaaattaacaaacacgtcgaaaattacttgatgtaaacataagatagaaaaca------ |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2488305 |
cataggtagcattagaactgtgtggaacatgaactcagtaagaaattaacaaacacgtcgaaaattacttgatgtaaacataagatagaaaacatactca |
2488206 |
T |
 |
| Q |
105 |
-----atgcaatgtaattattaatattgcgtagaattgcagtcaaatgcgactgatgcagtctcaatcgcagtggcgtcgctgtttcagcaacatcaaaa |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2488205 |
aaacaatgcaatgtaattattaatattgcgtagaattgcagtcaaatgcgactgatgcagtctcaatcgcagtggcgtcgctgtttcagcaacatcaaaa |
2488106 |
T |
 |
| Q |
200 |
acctttatctcatacgaaatttaccttattcgtggttctctagctactgtc |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2488105 |
acctttatctcatacgaaatttaccttattcgtggttctctagctactgtc |
2488055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University