View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2454_high_1 (Length: 215)
Name: NF2454_high_1
Description: NF2454
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2454_high_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 194
Target Start/End: Original strand, 52512464 - 52512657
Alignment:
| Q |
1 |
gaaattgaattgaaactcgtatataaacatacatacataccttggaggaagaatgatatccttgattttgaggaagagtggatttaacaataaaacaacg |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52512464 |
gaaattgaattgaaactcatatataaacatacatacataccttggaggaagaatgatatccttgattttgaggaagagtggatttaacaataaaacaacg |
52512563 |
T |
 |
| Q |
101 |
cgtccttcctgtttgtttgatggaagttggaggaaggcatcgaggaataacagacgcctgcaaattgcaatccattgagatatgaagaatagag |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52512564 |
cgtccttcctgtttgtttgatggaagttggaggaaggcatcgaggaataacagacgcctgcaaattgcaatccattgagatatgaagaatagag |
52512657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University