View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2454_low_17 (Length: 231)

Name: NF2454_low_17
Description: NF2454
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2454_low_17
NF2454_low_17
[»] chr7 (1 HSPs)
chr7 (131-229)||(47501198-47501296)


Alignment Details
Target: chr7 (Bit Score: 87; Significance: 8e-42; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 131 - 229
Target Start/End: Complemental strand, 47501296 - 47501198
Alignment:
131 gttttcttcgctaggcttccgtaaagtatgacaagcccgggaatgctttgaagcccatccattgttgctgctgttaactgccatgcgttgtcccctttg 229  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||    
47501296 gttttcttcactaggcttccgtaaagtatgacaagcccgggaatgctttgaagcccaaccattgttgctgctgttaattgccatgcgttgtcccctttg 47501198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University