View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2454_low_2 (Length: 236)
Name: NF2454_low_2
Description: NF2454
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2454_low_2 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 13 - 68
Target Start/End: Original strand, 14498842 - 14498897
Alignment:
| Q |
13 |
gagaaatgaacgaaatatatcaataaaggggtattgacttttgaatgtactttgaa |
68 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14498842 |
gagaaataaacaaaatatatcaataaaggggtattgacttttgaatgtactttgaa |
14498897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 109 - 157
Target Start/End: Original strand, 14498894 - 14498942
Alignment:
| Q |
109 |
tgaaaaatattcaaatttcaaaatacctattgaagtgtaccattcaact |
157 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
14498894 |
tgaaaaatattcaaattccgaaatacctattgaagtgtaccattcaact |
14498942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University