View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2455_low_14 (Length: 253)
Name: NF2455_low_14
Description: NF2455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2455_low_14 |
 | |
|
| [»] scaffold1587 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold1587 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: scaffold1587
Description:
Target: scaffold1587; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 475 - 715
Alignment:
| Q |
1 |
tcccaaagatggaaaatcattcgtctatagttatttagcctcatgggaccaaggattgggaagtgagcattccttcgttaaacagaaggatctgttatct |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
475 |
tcccaaagatggaaaatcattcgtttatagttatttagcctcatgggaccaaggattgggaagtgagcattccttcgttaaacagaaggatctgttatct |
574 |
T |
|
| Q |
101 |
ctatgtgcaa----gtctttaaggatatcggttttaggatgtggttttaggatttttagaaggaaatttacaagtggttaaagttaggcccctacaactt |
196 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
575 |
ctatgtgcaaatttgtctttaaggatatcggttttaggatgtggtttttggatttttagaaggaaatttacaagtggttaaagttaggctcctacaactt |
674 |
T |
|
| Q |
197 |
tatccaaacttgatggcgttcgttagagcattcgagttcat |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
675 |
tatccaaacttgatggcgttcgttagagcattcgagttcat |
715 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University