View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2455_low_6 (Length: 336)
Name: NF2455_low_6
Description: NF2455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2455_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 1 - 331
Target Start/End: Complemental strand, 45934338 - 45934014
Alignment:
| Q |
1 |
ggtttggattagggttagggtttcaccttcgaatgcatcaaaatacccaaattctacactatcaccaacaatgtacaactctatgaacatgtccgaccag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45934338 |
ggtttggattagggttagggtttcaccttcgaatgcatcaaaatacccaaattcgacactatcaccaacaatgtacaactctatgaacatgtccgaccag |
45934239 |
T |
 |
| Q |
101 |
atcaagaacagcgaagatcctgnnnnnnnnnnnnnnnnnnntcacatccatttcgattccccaaccctcgaagatgcttccggcgaaggtgaaggtcaaa |
200 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45934238 |
atcaagaacaacgaagatcctgacaacaacaacaa------tcacatccatttcgattcaccaaccctcgaagatgcttccggcgaaggtgaaggtcaaa |
45934145 |
T |
 |
| Q |
201 |
tcaatgatgtttcactcgaaaatgtttatgtgtccggcgatggaaaccaccctgatatgtctgttcaacaattcgacgattctagccagctcacactttc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45934144 |
tcaatgatgtttcactcgaaaatgtttatgtgtccggcgatggaaaccaccctgatatgtctgttcaacaattcgacgattctagccagctcacactttc |
45934045 |
T |
 |
| Q |
301 |
gtttcgtggccaagtttatgcctttgcttct |
331 |
Q |
| |
|
|||||||||||||||||||| ||||| |||| |
|
|
| T |
45934044 |
gtttcgtggccaagtttatgtctttgattct |
45934014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University