View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2456_high_3 (Length: 301)
Name: NF2456_high_3
Description: NF2456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2456_high_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 1331376 - 1331175
Alignment:
| Q |
1 |
atttgcatcaacaatgtcgtcatcatcaacaaaattttcaacatgagtaataacaagtgttgcacccgcgcttcaaaagccttggaggatgctatgccgt |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
1331376 |
atttgcatcaacaatgtcgtcattatcaacaaaattttcaacatgagtaataacaagtg--------gcacttcaaaagccttggaggatgctatgccgt |
1331285 |
T |
 |
| Q |
101 |
atgtattctccttgtcaacatatttatgaattgttttctttgaaacatatgc-gggnnnnnnnnaccacgatctacattttccacaaccttccgagggat |
199 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||| ||||||||||| || |||| |||||||||||||||||| |||||||||||| |
|
|
| T |
1331284 |
atgcattctccttgtcaacatatttatgaattgttttcttcgaaacatatgcaggtttttttttaccatgatctacattttccacaatcttccgagggat |
1331185 |
T |
 |
| Q |
200 |
taaccaacga |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
1331184 |
caaccaacga |
1331175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University