View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2456_high_7 (Length: 251)
Name: NF2456_high_7
Description: NF2456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2456_high_7 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 16 - 251
Target Start/End: Complemental strand, 21940744 - 21940509
Alignment:
| Q |
16 |
attgttctttgacaaatcaacatatgcaatatgaggaagatggctgaattttaaaggaatctctcctgagaatgaattatcttctatgcgaagacggaca |
115 |
Q |
| |
|
||||||| ||||||||||||||||| |||| |||||||||| |||| |||||| ||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
21940744 |
attgttccatgacaaatcaacatatgtgatatcaggaagatggttgaagtttaaataaatctctcctgagaatgaattatcttctaagcgaagacggaca |
21940645 |
T |
 |
| Q |
116 |
agggaagaacatttcgagatcgaaaaaagactacctgtgaatttgtttgaaaacaggataagcttaaatagcactccactaagacaaacatctgacggta |
215 |
Q |
| |
|
||||||||||| || | ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||| | ||||| |
|
|
| T |
21940644 |
agggaagaacaatttgcaatcgaaaaaagactacctgtgaatttgtttgaaaacaggataagcttaaatagtactccactaagacaaatatccggcggta |
21940545 |
T |
 |
| Q |
216 |
tgctaccactgaagttgtttgtggagacatccaccc |
251 |
Q |
| |
|
|||| ||| |||||||||||||||||||||| |||| |
|
|
| T |
21940544 |
tgctgccattgaagttgtttgtggagacatctaccc |
21940509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University