View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2456_low_1 (Length: 372)
Name: NF2456_low_1
Description: NF2456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2456_low_1 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 161; Significance: 9e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 161; E-Value: 9e-86
Query Start/End: Original strand, 72 - 354
Target Start/End: Original strand, 34575786 - 34576054
Alignment:
| Q |
72 |
atacaatataaaaggacaatttcaaaatttannnnnnnctgtgaccaattgagggggcgtnnnnnnnnnnnnnnnnnntatctctcagtaagaaagcaga |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
34575786 |
atacaatataaaaggacaatttcaaaatttagggggggctgtgaccaattgagggggcgtaaaaagaaataaaaaaaatatctctcagtaagaaagcaga |
34575885 |
T |
 |
| Q |
172 |
tgaacaaacaagtccagacatcaaacgaaactatttgaaaagcggttcagaattctctcagtcggtgattaaaaagaaggaactgaaaatgctacagttt |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
34575886 |
tgaacaaacaagtccagacatcaaacgaaactatttgaaaagcggttcagaattctctcagtcggtgattaaaaa--------------tgctacagttt |
34575971 |
T |
 |
| Q |
272 |
ccggcgtttatgacacagtaccaattatcgactcggattccgacgtcgtttttgctaccatctcaatggcctcagcctcaaaa |
354 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34575972 |
ccggcgtttatgacacagtaccaattatcgactcggattccgacgtcgtttttgctaccatctcaatggcctcagcctcaaaa |
34576054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University