View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2456_low_17 (Length: 270)
Name: NF2456_low_17
Description: NF2456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2456_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 99; Significance: 6e-49; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 122 - 246
Target Start/End: Complemental strand, 4376155 - 4376034
Alignment:
| Q |
122 |
ttatgaacaaaggagtgtattatgatgctgctcctcctttcagagtatcagtattcatattttcttcctttttaccaagagtgcaaacaatctcaaaaga |
221 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4376155 |
ttatgaacaaaggagtgtattatg---ctgcgtctcctttcagagtatcagtattcatattttcttcctttttaccaagagtgcaaacaatctcaaaaga |
4376059 |
T |
 |
| Q |
222 |
tcaaacacgtattcatgttcatttc |
246 |
Q |
| |
|
|||||||||||||||||||| |||| |
|
|
| T |
4376058 |
tcaaacacgtattcatgttcttttc |
4376034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University