View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2456_low_21 (Length: 223)
Name: NF2456_low_21
Description: NF2456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2456_low_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 85; Significance: 1e-40; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 15 - 99
Target Start/End: Original strand, 31131289 - 31131373
Alignment:
| Q |
15 |
cagccaacttccaccgcctcatacaatggatttctgacatcctccaaactataccttcctccacctttgtcctccaccgcccctt |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31131289 |
cagccaacttccaccgcctcatacaatggatttctgacatcctccaaactataccttcctccacctttgtcctccaccgcccctt |
31131373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 17 - 105
Target Start/End: Original strand, 31126583 - 31126671
Alignment:
| Q |
17 |
gccaacttccaccgcctcatacaatggatttctgacatcctccaaactataccttcctccacctttgtcctccaccgcccctttggttc |
105 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||| || |||||||| || |||||||||||||| || |||||||| |||| ||||| |
|
|
| T |
31126583 |
gccaacttccaccgccgcatacaatggatagctgatattctccaaaccatcccttcctccaccttcatcttccaccgcgccttcggttc |
31126671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 17 - 105
Target Start/End: Original strand, 31077265 - 31077353
Alignment:
| Q |
17 |
gccaacttccaccgcctcatacaatggatttctgacatcctccaaactataccttcctccacctttgtcctccaccgcccctttggttc |
105 |
Q |
| |
|
|||||||||||||||| | || ||||| || |||||||||||||| || ||||| |||||||| ||||||||||| |||| ||||| |
|
|
| T |
31077265 |
gccaacttccaccgccgtgtccactggatctccgacatcctccaaaccatcccttcttccaccttcatcctccaccgctccttcggttc |
31077353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University