View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2456_low_7 (Length: 331)
Name: NF2456_low_7
Description: NF2456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2456_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 59 - 302
Target Start/End: Complemental strand, 29104156 - 29103914
Alignment:
| Q |
59 |
tatttaattgacatacgaacgattaaactaatatcttgtnnnnnnnnncacaacacaaggaatgtaagactaaatcagattttgtgatgcacaataaaag |
158 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29104156 |
tatttaattgacatacgaatgattaaactaatatcttgtaaaaaaaa-cacaacacaaggaatgtaagactaaatcagattttgtgatgcacaataaaag |
29104058 |
T |
 |
| Q |
159 |
acacccgatattactttttagtgatcacactgtcacaccagtctcaacggaccaaatttaagtcacctgttctttcatcgactatacaacctacgtatta |
258 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29104057 |
acacccgatattactttttagtgatcacagtgtcacaccagtctcaacggaccaaatttaagtcacctgttctttcatcgactatacaacctacgtatta |
29103958 |
T |
 |
| Q |
259 |
aaaaactatttacatctgttgcttatccttggcgtgtttacttt |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29103957 |
aaaaactatttacatctgttgcttatccttggcgtgtttacttt |
29103914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University