View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2456_low_9 (Length: 304)
Name: NF2456_low_9
Description: NF2456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2456_low_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 243; Significance: 1e-135; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 14 - 268
Target Start/End: Original strand, 6887639 - 6887893
Alignment:
| Q |
14 |
gagatgaacgaatccgtgaaaatcgtgaaagaatgggaaaattgggtattctcgacatttcactttccctcaagctcaaacctaaccccccaccttcacg |
113 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6887639 |
gagaagaacgaatccgtgaaaatcgtgaaagaatgggaaaattgggtattctcgacatttcactttccctcaagctcaaacctaaccccccaccttcacg |
6887738 |
T |
|
| Q |
114 |
cagaaccccttctaacaaccctaaatccccaatttctcttaacccttctggcccatctcgccgatcttccaggttcttacatttttgccctaaaaattta |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
6887739 |
cagaaccccttctaacaaccctaaatccccaatttctcttaacccttctggcccatctcgccgatcttccaggttcttacatttttgacctaaaaattta |
6887838 |
T |
|
| Q |
214 |
atctttcatatgtttagctaagaaggttttaaataactgtcgcggtttaggttgc |
268 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
6887839 |
atctttcatatgtttagctaaaaaggttttaaataactgtcgcggtttaggttgc |
6887893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 14 - 234
Target Start/End: Original strand, 6858577 - 6858794
Alignment:
| Q |
14 |
gagatgaacgaatccgtgaaaatcgtgaaagaatgggaaaattgggtattctcgacatttcactttccctcaagctcaaacctaaccccccaccttcacg |
113 |
Q |
| |
|
|||| ||| ||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
6858577 |
gagaagaaagaatccgcgaaaatcacgaaagaatgggaaaattgggtattctcgacatttcactttccctcaagctcaaacctaaccc---accttcacg |
6858673 |
T |
|
| Q |
114 |
cagaaccccttctaacaaccctaaatccccaatttctcttaacccttctggcccatctcgccgatcttccaggttcttacatttttgccctaaaaattta |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| | |
|
|
| T |
6858674 |
cagaaccccttctaacaaccctaaatccccaatttctctcaacccttctggcccatctcgccgatcttccaggttcttccatttttgccctaaaaattca |
6858773 |
T |
|
| Q |
214 |
atctttcatatgtttagctaa |
234 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
6858774 |
atctttcatatgtttagctaa |
6858794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 14 - 86
Target Start/End: Original strand, 6849186 - 6849258
Alignment:
| Q |
14 |
gagatgaacgaatccgtgaaaatcgtgaaagaatgggaaaattgggtattctcgacatttcactttccctcaa |
86 |
Q |
| |
|
|||| ||| ||||||| |||||||||||||||||||||||||||||| || |||||||||| || |||||||| |
|
|
| T |
6849186 |
gagaagaaagaatccgagaaaatcgtgaaagaatgggaaaattgggtcttttcgacatttcgctctccctcaa |
6849258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University