View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2458_low_3 (Length: 239)
Name: NF2458_low_3
Description: NF2458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2458_low_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 19 - 199
Target Start/End: Original strand, 36689787 - 36689967
Alignment:
| Q |
19 |
ctagggtcatcttggccaatctcttttaccatatttatgaccttcactaacttagcccatgatttcttaaccaagtttcgaaaggtatgtgtggagtctg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
36689787 |
ctagggtcatcttggccaatctcttttaccatatttatgaccttcactaacttagcccatgatttcttaaccaagtttcgaaaggtatatgtggagtctg |
36689886 |
T |
 |
| Q |
119 |
ctgtagtggattcaacatttggtgacaccattttgaaaaattggtcttaattcaagggaactaaagtgcttgaagtgcaca |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36689887 |
ctgtagtggattcaacatttggtgacaccattttgaaaaattggtcttaattcaagggaactaaagtgcttgaagtgcaca |
36689967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University