View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2459_high_1 (Length: 583)
Name: NF2459_high_1
Description: NF2459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2459_high_1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 127; Significance: 3e-65; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 127; E-Value: 3e-65
Query Start/End: Original strand, 4 - 202
Target Start/End: Complemental strand, 5361086 - 5360888
Alignment:
| Q |
4 |
atgtcgaagaatatgtttttccttatacaatagtattgccttttaaaaaacttttcttatatgatttttgccatataaataaattctagaaatgtccaat |
103 |
Q |
| |
|
||||| || |||||| |||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||| ||| |
|
|
| T |
5361086 |
atgtccaataatatgatttttcttatacaatagtattgccttttaaaaaactttttttatatgatttttgccatataaacaaattctagaaatgtcaaat |
5360987 |
T |
 |
| Q |
104 |
tacaattttcgtgagcataactcaattaatatgaacattatactatatatgtaggggtggagtttaaacattaaattttccatttattcattttaaatg |
202 |
Q |
| |
|
||||||||| | || | ||||||||| ||||||| |||||| |||||||||||||||||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
5360986 |
tacaatttttataagtacaactcaattgatatgaatattatattatatatgtaggggtggagtttaataattaaattttccatttattcactttaaatg |
5360888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University