View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2459_high_14 (Length: 339)
Name: NF2459_high_14
Description: NF2459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2459_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 21 - 315
Target Start/End: Original strand, 20817907 - 20818199
Alignment:
| Q |
21 |
atcctcttcacatctttaccattcacaagccgtcgtcgttttctttttcaaagcgccgtagtccttaagtgacattgtcgttttctaagagtttgctatc |
120 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| ||| ||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
20817907 |
atcctcttcacatctttaccattaacaagccgtagtcattttctttttcaaagcgccatagtccttaagtgacattgtcgtttcctaagagtttgctatg |
20818006 |
T |
 |
| Q |
121 |
gtgatttctctgtctctatgattttgttttggagaagtatgaaatcaaatgatttttgtctttagttgctatgttttctgcaaaaagaaaatttattctg |
220 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
20818007 |
gtgatttct--gtctctatgattttgttttggagaagtatgaaatcaaatgatttttgtctttagttactatgttttctgcaaaaagaaaatttattctg |
20818104 |
T |
 |
| Q |
221 |
cagaggcaatcgttttttcaccgtaagtttgatttttccttttacaagaaaagaattcgaaaggtatgcctgcatcacatgctcttatgttttct |
315 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
20818105 |
cagatgcaatcgttttttcaccgtaagtttgatttttccttttacaagaaaagaatttgaaaggtatgcctgcatcacatactcttctgttttct |
20818199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University