View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2459_high_30 (Length: 248)
Name: NF2459_high_30
Description: NF2459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2459_high_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 92; Significance: 8e-45; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 7 - 98
Target Start/End: Original strand, 56230468 - 56230559
Alignment:
| Q |
7 |
gagatgaagggatagggcccattccctcaaggtggaaaggaacttgtcagagtgatcacacaggcttccgttgcaacaggtccactctttta |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56230468 |
gagatgaagggatagggcccattccctcaaggtggaaaggaacttgtcagagtgatcacacaggcttccgttgcaacaggtccactctttta |
56230559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 168 - 247
Target Start/End: Original strand, 56230637 - 56230720
Alignment:
| Q |
168 |
gtatgctatgtgttctgatc----ggttacacattctttactatcgctaattatagtattgcttgtgtttactatatatctcta |
247 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
56230637 |
gtatgctatgtgttctgatcagttagttacacattctttactatcgctaattatagtattgcttgtgtttactatatgtctcta |
56230720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 77; Significance: 8e-36; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 7 - 87
Target Start/End: Original strand, 39188286 - 39188366
Alignment:
| Q |
7 |
gagatgaagggatagggcccattccctcaaggtggaaaggaacttgtcagagtgatcacacaggcttccgttgcaacaggt |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
39188286 |
gagatgaagggatagggcccattccctcaaggtggaaaggaacttgtcagaatgatcacacaggcttccgttgcaacaggt |
39188366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University