View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2459_high_5 (Length: 415)
Name: NF2459_high_5
Description: NF2459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2459_high_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 380; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 380; E-Value: 0
Query Start/End: Original strand, 19 - 402
Target Start/End: Complemental strand, 48961566 - 48961183
Alignment:
| Q |
19 |
acactgtacattgctgttcatgtatgcagccattggaattgaagattttgttcttcctttgttattcttatctttcttgtttatttttccttcatcagca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48961566 |
acactgtacattgctgttcatgtatgcagccattggaattgaagattttgttcttcctttgttattcttatctttcttgtttatttttccttcatcagca |
48961467 |
T |
 |
| Q |
119 |
cttgaactctcagattcaccaccatcaactttgattgtgttccccttcttgtgaagataattgggttggtgtttcttttgggattgaactagttccatat |
218 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48961466 |
cttgaactctcagattcaccaccgtcaactttgattgtgttccccttcttgtgaagataattgggttggtgtttcttttgggattgaactagttccatat |
48961367 |
T |
 |
| Q |
219 |
aggctcctctgttttcccctgcaattgttatcactctcatgccagagtcctcagaatctgaaaactttttctccttgctggattctcttcctttcacagt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48961366 |
aggctcctctgttttcccctgcaattgttatcactctcatgccagagtcctcagaatctgaaaactttttctccttgctggattctcttcctttcacagt |
48961267 |
T |
 |
| Q |
319 |
aatgtgttttccatgatgggaagaattgctgtgattttgagtctgcctatggaattcaccattgctgtgattttgattctccct |
402 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48961266 |
aatgtgttttccatgatgggaagaattgctgtgattttgagtctgcctatggaattcaccattgctgtgattttgattctccct |
48961183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University