View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2459_high_6 (Length: 404)
Name: NF2459_high_6
Description: NF2459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2459_high_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 139; Significance: 1e-72; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 168 - 338
Target Start/End: Original strand, 4610796 - 4610966
Alignment:
| Q |
168 |
gtaaccaagtggtttacatctagtaaagaatttggtttggtttcttttaaagaatacaactctgtactcatagcaattgttatcagtaccttacgataca |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4610796 |
gtaaccaagtggtttacatctagtaaagaatttggtttggtttcttttaaagaatacaactctgtactcatagcaattgttatcagtaccttacgataca |
4610895 |
T |
|
| Q |
268 |
cgccattcatatctcatttcaatgcagaactagatcgaatcaatacgaatttctaatgtgtatcgcgagcc |
338 |
Q |
| |
|
|| | || ||||||||||||||||| |||| |||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
4610896 |
tgcgactcgtatctcatttcaatgcaaaactggatcaaatcaatacgaatttctagtgtgtatcgcgagcc |
4610966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 18 - 82
Target Start/End: Original strand, 4610646 - 4610710
Alignment:
| Q |
18 |
gtcacagtattggagaaatttgagaggaaactaaagatgtaatgatgttagttagtgctttggaa |
82 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4610646 |
gtcacagtattggagaaatttgagaggaaactaaagatgtaatgatgttagttagtgctttggaa |
4610710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 342 - 391
Target Start/End: Original strand, 4610997 - 4611046
Alignment:
| Q |
342 |
atggtaaatcatgattcattctaatggtttcctttgtcaagttatttcct |
391 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
4610997 |
atggtaaatcatgatttattttaatggtttcctttgtcaagttatttcct |
4611046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University