View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2459_low_18 (Length: 334)
Name: NF2459_low_18
Description: NF2459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2459_low_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 25 - 319
Target Start/End: Original strand, 29997141 - 29997437
Alignment:
| Q |
25 |
ttgcaagagattgtaaagcgacggtgcgtgcgtcggaaatgagcagagg------aggaggagtttgcgtttagcagcttctgagatgattgtcttccac |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
29997141 |
ttgcaagagattgtaaagcgacggtgcgtgcgtcggaaatgagcagaggaggaggaggaggagtttgcgttaagcagcttctgagatgattgtcttccac |
29997240 |
T |
 |
| Q |
119 |
cgttgaaattgagtttcacagaatacaaagaaggcgtccatagcaaagttgacatgattgattgattaatatcaatgctttttgcgtcttccttatttct |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29997241 |
cgttgaaattgagtttcacagaatacaaagaaggcgtccacagcaaagttgaca----tgattgattaatatcaatgctttttgcgtcttccttatttct |
29997336 |
T |
 |
| Q |
219 |
ttctactaacttacataaaaatgccagtttctcgttgcgtcacgtcacgcttcttctcttaaataaatatcaaattca-tttttcaattttgttaaaata |
317 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
29997337 |
ttctact-acttacataaaaatgccagtttctcgttgcgtcacgtcacgcttcttctcttaaataaatatcaaattcattttttcaaatttgttaaaata |
29997435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University