View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2459_low_24 (Length: 278)
Name: NF2459_low_24
Description: NF2459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2459_low_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 3 - 254
Target Start/End: Complemental strand, 52376773 - 52376522
Alignment:
| Q |
3 |
aggaggagcacagacaccaacaacagatggttcatccaataaatcaccacaacaagcaccaacaaatgcaccatcaaacgaaccaagcaaaacacctgaa |
102 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52376773 |
aggaggagcaccgacaccaacagcagatggttcatccaataaatcaccacaacaagcaccaacaaatgcaccatcaaacgaaccaagcaaaacacctgaa |
52376674 |
T |
 |
| Q |
103 |
tctgcacccacaaatgcacccacagcagcatccaccaacgcgcctgcagaggcaccaaaaggcaatggcgagaatgtagccggtagttctaaagcacctg |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
52376673 |
tctgcacccacaaatgcacccacagcagcatccaccaacgcgcctgcagaggcaccaaaaggcaatggcgcgaatgtagccggtagttctaaagcacctg |
52376574 |
T |
 |
| Q |
203 |
gaagtgctccaattgtgtcgccagccggagcacctcaaggggatctaacaga |
254 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
52376573 |
aaagtgctccaattgtgtctccaaccggagcacctcaaggggatctaacaga |
52376522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University