View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2459_low_25 (Length: 274)
Name: NF2459_low_25
Description: NF2459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2459_low_25 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 8e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 39 - 233
Target Start/End: Original strand, 28399604 - 28399792
Alignment:
| Q |
39 |
acatttttatagtgaatgtggggattatagtttacatttaaataacaacaatataattgttaaagttcaacgaattgtcaaacgccttttaagaaaacaa |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
28399604 |
acatttttatagtgaatgtggggattatagtttacatttaaataacaacaatataattgttaaagttcaacgaattgtcaaacgcctttcaagaaaacaa |
28399703 |
T |
|
| Q |
139 |
aagaacaaattgtcaaacgtaaatttatgagcacnnnnnnncactaaagtactactattaaataattcatacatcactcaatcactcaccatata |
233 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28399704 |
aagatcaaattgtcaaacgtaaatttatgagcactttttttaactaaag------tattaaataattcatacatcactcaatcactcaccatata |
28399792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University