View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2459_low_27 (Length: 263)
Name: NF2459_low_27
Description: NF2459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2459_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 139; Significance: 8e-73; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 95 - 245
Target Start/End: Original strand, 21268748 - 21268898
Alignment:
| Q |
95 |
ggttttgaaagtctatatgcattgcgaaggttgcgctaacaaagtaaccaaacaccttaacagtatcaaaggtatcatttttctcacactcctctgtttc |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
21268748 |
ggttttgaaagtctatatgcattgcgaaggttgcgctaacaaagtcaccaaacaccttaacggcatcaaaggtatcatttttctcacactcctctgtttc |
21268847 |
T |
 |
| Q |
195 |
tacacattttttccgatctgggttttcatcattgttcttcaattcattttt |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21268848 |
tacacattttttccgatctgggttttcatcattgttcttcaattcattttt |
21268898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University