View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2459_low_29 (Length: 256)
Name: NF2459_low_29
Description: NF2459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2459_low_29 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 136 - 246
Target Start/End: Complemental strand, 7323098 - 7322988
Alignment:
| Q |
136 |
cattcctttaaggtctatagctggctgttttactgatttcataaagatattacagtgattcttaccaaaactgttctgggaaagcacttccttcttttaa |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
7323098 |
cattcctttaaggtctatagctggctgttttactgatttcataaagatattacagtgattcttaccaaaactgttccgggaaagcacttccttcttttaa |
7322999 |
T |
|
| Q |
236 |
catgtcctttg |
246 |
Q |
| |
|
||||||||||| |
|
|
| T |
7322998 |
catgtcctttg |
7322988 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 16 - 72
Target Start/End: Complemental strand, 7323218 - 7323162
Alignment:
| Q |
16 |
ccttaatgtacaactgttggtatattacttaagctttaggtacaattcatctttgcc |
72 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7323218 |
ccttaatgtagaactgttggtatattacttaagctttaggtacaattcatctttgcc |
7323162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University