View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2459_low_39 (Length: 235)
Name: NF2459_low_39
Description: NF2459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2459_low_39 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 33861358 - 33861129
Alignment:
| Q |
1 |
attcttgctaccctaatttccttgtacattatcaaagttcgaaacagatttgattgctttctttgttatgatggtgatttatatgtataattatctaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33861358 |
attcttgctaccctaatttccttgtacattatcaaagttcgaaacagatttgattgctttctttgttatgatggtgatttatatgtataaatatctaaat |
33861259 |
T |
 |
| Q |
101 |
gatcatgagaattggagattgaacataatagccttcattt------------atttcgaaatactttattccatttcaagactacatcagtgaactaatg |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
33861258 |
gatcatgagaattggagattgaacataatagccttcatttatttattaatttatttcgaaatact---ttccatttcaagactacatcagtgaactaatg |
33861162 |
T |
 |
| Q |
189 |
cagagacataactcatgttgccaaggtggtttt |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
33861161 |
cagagacataactcatgttgccaaggtggtttt |
33861129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University