View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2459_low_43 (Length: 230)
Name: NF2459_low_43
Description: NF2459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2459_low_43 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 12 - 214
Target Start/End: Original strand, 29208467 - 29208669
Alignment:
| Q |
12 |
tgagatgaagattgtgaaccgttcttgacaaacttttggccatggaaaattaaggaaattgcaaaagaaagtgaaacaattaggacatagtattaattaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29208467 |
tgagatgaagattgtgaaccgttcttgacaaacttttggccatggaaaattaaggaaaatgcaaaagaaagtgaaacaattaggacatagtattaattaa |
29208566 |
T |
 |
| Q |
112 |
ctaagaggaagtagaacaaaactacattataaaaaattaatcactagtccaaccttcaaagtagatttagtgtttgctctctccatgtttaagtggaata |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29208567 |
ctaagaggaagtagaacaaaactacattataaaaaattaatcactagtccaaccttcaaagtagatttagtgtttgctctctccatgtttaagtggaata |
29208666 |
T |
 |
| Q |
212 |
aat |
214 |
Q |
| |
|
||| |
|
|
| T |
29208667 |
aat |
29208669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 12 - 121
Target Start/End: Complemental strand, 38378198 - 38378088
Alignment:
| Q |
12 |
tgagatgaagattgtgaaccgttcttgacaaacttttggccatggaaaattaaggaaattgcaaa--agaaagtgaaacaattaggacatagtattaatt |
109 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||||| || |||||||||||||| |||||| |||| | ||||||||||||| ||||||||||| |
|
|
| T |
38378198 |
tgagatgaagactgtgaagtgttcttgacaaacttttcaccgcagaaaattaaggaaaatgcaaagtagaatg-gaaacaattaggaattagtattaatt |
38378100 |
T |
 |
| Q |
110 |
aactaagaggaa |
121 |
Q |
| |
|
||| |||||||| |
|
|
| T |
38378099 |
aaccaagaggaa |
38378088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 159 - 208
Target Start/End: Complemental strand, 38377782 - 38377733
Alignment:
| Q |
159 |
tccaaccttcaaagtagatttagtgtttgctctctccatgtttaagtgga |
208 |
Q |
| |
|
||||||||||||| ||||| |||||||| |||||||||||||||||||| |
|
|
| T |
38377782 |
tccaaccttcaaaacagattcagtgtttggtctctccatgtttaagtgga |
38377733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University