View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2459_low_44 (Length: 227)
Name: NF2459_low_44
Description: NF2459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2459_low_44 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 1 - 209
Target Start/End: Original strand, 2567668 - 2567874
Alignment:
| Q |
1 |
aagaaaaaccattgccctaacacgtgtagttgtaattccaccaatccgttgacgttggtttggcttgatctacactttccctttgtgttctagtggttgt |
100 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2567668 |
aagaaaaaccattgcccgaacacgtgtagttgtaattccaccaatccgttgacgttggtttggcttgatctacactttcccttagtgttctagtggttgt |
2567767 |
T |
 |
| Q |
101 |
aattgtaacactgtggatatatggattgtttgtggatatatagannnnnnnnggttacattgtggatatatagatatgaataagcatgtgtaatattgca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
2567768 |
aattgtaacactgtggatatatggattgtttgtggatatatagattttttttggttacattgtggatatatagatatgaataagca--tgtaatattgca |
2567865 |
T |
 |
| Q |
201 |
tttatttat |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
2567866 |
tttatttat |
2567874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University