View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2459_low_46 (Length: 226)
Name: NF2459_low_46
Description: NF2459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2459_low_46 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 80; Significance: 1e-37; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 117 - 210
Target Start/End: Original strand, 1205192 - 1205282
Alignment:
| Q |
117 |
taacaaatttatatatgtacacttttctcattctcctcaaaagagcatcctagttttacaagacttcttgtcaacaaaaataggtagttcataa |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
1205192 |
taacaaatttatatatgtacacttttctcattctcctcaaaagagcatcctagttttacaaga---cttgtcaacaaaaataggtagttcataa |
1205282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 14 - 67
Target Start/End: Original strand, 1205019 - 1205072
Alignment:
| Q |
14 |
gcaaaggtggtagattggtgttttgtgatcaatgaaagaaactgtgtggctcaa |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1205019 |
gcaaaggtggtagattggtgttttgtgatcaatgaaagaaactgcgtggctcaa |
1205072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 78 - 110
Target Start/End: Original strand, 1205086 - 1205118
Alignment:
| Q |
78 |
ttgttacaatttccgtgtaatattattacataa |
110 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
1205086 |
ttgttacaatttgcgtgtaatattattacataa |
1205118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University