View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2459_low_49 (Length: 216)
Name: NF2459_low_49
Description: NF2459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2459_low_49 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 32245922 - 32246137
Alignment:
| Q |
1 |
tgcaaacatcttttgctctttaagatatgtccctccttaatattaaaacgaatattaaaataattattcctgcaaccattcaatcatgtattacaataaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||| |
|
|
| T |
32245922 |
tgcaaacatcttttgctctttaagatatgtccctccttaatattaaaacgaatattaaaataattattcgtgcaaccattcaatcatgtattacaacaaa |
32246021 |
T |
|
| Q |
101 |
aatatctatgcagatactaatatgagaaccaatattacagcgtgatcactatgataaataattatatctgtatgcttcaaaattcatatattcatttcaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32246022 |
aatatctatgcagatactaatatgagaaccaatattacagcgtgatcactatgataaataattatatctgtatgcttcaaaattcatatattcatttcaa |
32246121 |
T |
|
| Q |
201 |
atttattttcctttca |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
32246122 |
atttattttcctttca |
32246137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University