View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2460_low_16 (Length: 364)
Name: NF2460_low_16
Description: NF2460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2460_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 138; Significance: 4e-72; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 70 - 278
Target Start/End: Complemental strand, 3470607 - 3470400
Alignment:
| Q |
70 |
gttattttaaggataattatggaagatgttttaggatttgtcaacnnnnnnnn-tggaagattgtttaggtatannnnnnngttattttaaggataatta |
168 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
3470607 |
gttattttaaggataattatggaagatgttttaggatttgtcaacaaaaaaaaatggaagatgttttaggtatatttttttgttattttaaggataatta |
3470508 |
T |
|
| Q |
169 |
tggaagatgttttagttttgtaccatcaatgattaattggcctacagccccacacacatgtgacattcttaactattaaattgatgcttttcaaattata |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3470507 |
tggaagatgttttagttttgtaccatcaatgattaattggcctacagcccca--cacatgtgacattcttaactattaaattgatgcttttcaaattata |
3470410 |
T |
|
| Q |
269 |
gttctatgtg |
278 |
Q |
| |
|
|||||||||| |
|
|
| T |
3470409 |
gttctatgtg |
3470400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 103
Target Start/End: Complemental strand, 3470596 - 3470493
Alignment:
| Q |
1 |
gataattatggaagatgttttaggatttgtcaac-nnnnnnnntggaagattgtttaggtatannnnnnngttattttaaggataattatggaagatgtt |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3470596 |
gataattatggaagatgttttaggatttgtcaacaaaaaaaaatggaagatgttttaggtatatttttttgttattttaaggataattatggaagatgtt |
3470497 |
T |
|
| Q |
100 |
ttag |
103 |
Q |
| |
|
|||| |
|
|
| T |
3470496 |
ttag |
3470493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University