View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2460_low_19 (Length: 342)
Name: NF2460_low_19
Description: NF2460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2460_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 8e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 8e-86
Query Start/End: Original strand, 102 - 324
Target Start/End: Complemental strand, 41238455 - 41238221
Alignment:
| Q |
102 |
gatttggtcaactagctcaactcttttgatgtgttgaagatctatgatggggatggtggtgaagctggattcatgagtaggtgaatttt----------- |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41238455 |
gatttggtcaactagctcaactcttttgatgtgttgaagatctatgatggggatggtggtgaagctggattcatgagtaggtgaattttgagtagatttt |
41238356 |
T |
 |
| Q |
191 |
-ccaagttaacatgaaaaaaggaaggtatctttgttatgccagaatctagtataccttttacaccaattttggaatcatcaaatgcttgaacttgtgcnn |
289 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
41238355 |
tccaagttaacatgaaaaatggaaggtatctttgttatgccagaatctagtataccttttacaccagttttggaatcatcaaatgcttgaacttgtgctt |
41238256 |
T |
 |
| Q |
290 |
nnnnnaagtcactaaatgattctaatgatgccata |
324 |
Q |
| |
|
||||| |||||||||||||||||||||||| |
|
|
| T |
41238255 |
tttttaagtcgctaaatgattctaatgatgccata |
41238221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University