View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2460_low_20 (Length: 342)
Name: NF2460_low_20
Description: NF2460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2460_low_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 153; Significance: 5e-81; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 153; E-Value: 5e-81
Query Start/End: Original strand, 104 - 260
Target Start/End: Complemental strand, 38087581 - 38087425
Alignment:
| Q |
104 |
gttagagcttttgatagagttgtcattgatgtgcattactacaacttattttctgatcagttctcaaacatgaatgtgaagcagaacattgattatatta |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38087581 |
gttagagcttttgatagagttgtcattgatgtgcattactacaacttattttctgatcagttctcaaacatgaatgtgaagcagaacattgattatatta |
38087482 |
T |
 |
| Q |
204 |
aatatcatagagcttctgaccttagatctctgaccccatctaatggacccctcatct |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
38087481 |
aatatcatagagcttctgaccttagatctctgaccacatctaatggacccctcatct |
38087425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University