View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2460_low_32 (Length: 272)
Name: NF2460_low_32
Description: NF2460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2460_low_32 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 30 - 223
Target Start/End: Original strand, 48486820 - 48487015
Alignment:
| Q |
30 |
agattattcttaatatgagcgaatacaagccaaatattcttgcaggcagaacaacaaccaaaatcaca--cacaaacacaaacctatccatgaattccaa |
127 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
48486820 |
agattattcttaatatgagcgagtacaagccaaatattcttgcaggcagaacaacaaccaaaatcacacacacaaacacaaacctatccatgaattccaa |
48486919 |
T |
|
| Q |
128 |
gaaggggaataccatcccctgcttcgcccatgcatagtcctgccaagtgcccatcacaaattcattagatttcaacaataacaacaactcaaacct |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48486920 |
gaaggggaataccatcccctgcttcgcccatgcatagtcctgccaagtgcccatcacaaattcattagatttcaacaataacaacaactcaaacct |
48487015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University