View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2460_low_34 (Length: 268)
Name: NF2460_low_34
Description: NF2460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2460_low_34 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 31 - 220
Target Start/End: Complemental strand, 18943978 - 18943789
Alignment:
| Q |
31 |
agactaatcactcgtcagataagacctctgtgaatgccaaaacatatttaaaactgctgcgtttctaacgttagatttgaacccatacttgtaattaagc |
130 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
18943978 |
agactaatcgctcgtcagataagacctctgtgaatgccaaaacatatttaaaactgctgcatttctaacgttagatttgaacccatacctgtaattaagc |
18943879 |
T |
|
| Q |
131 |
ttaaaagatcatttgtcatctcattcagatgcttttggtaaacctgctctttgaaatgatggatcggagaagtacattttccttgtattt |
220 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
18943878 |
ttaaaagatcatttgtcatctcattcaaatgcttttggtaaacctgctcttggaaatgacggatcggagaagtacattttccttgtattt |
18943789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University