View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2460_low_42 (Length: 204)
Name: NF2460_low_42
Description: NF2460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2460_low_42 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 1 - 117
Target Start/End: Complemental strand, 40193200 - 40193084
Alignment:
| Q |
1 |
ggattagtttataatctaattgacaatcgatttatcaaaaatttgtcaaaaataaatcgatttatcaaaaaagtgctaatattcatttagcttttagtaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40193200 |
ggattagtttataatctaattgacaatcgatttatcaaaaatttgtcaaaaaaaaatcgatttatcaaaaaagtgctaatattcatttagcttttagtaa |
40193101 |
T |
|
| Q |
101 |
gactaaggacgtgatat |
117 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
40193100 |
gactaaggacgtgatat |
40193084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University