View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2461_low_10 (Length: 236)
Name: NF2461_low_10
Description: NF2461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2461_low_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 188; Significance: 1e-102; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 29732683 - 29732462
Alignment:
| Q |
1 |
tcccctcacaacccat---cattatcgaacgtggcactactgttgctggttcgattccaaatgcggacaaggcggtaggaagagcttccatagacgaaga |
97 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29732683 |
tcccctcacaacccatgatcattatcaaacgtggcactacggttgctggttcgattccaaatgcggacaaggcggaaggaagagcttccatagacgaaga |
29732584 |
T |
|
| Q |
98 |
cttgctggaagtagagccgacgcagacagagttgaggaaggagatgattccgaagcatgtggcagtgattatggacggaaatgggaggtgggcaaagatg |
197 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
29732583 |
cttgctggaagtagagctgacgcagacagagttgaggaaggagatgattccgaagcatgtggcggtgattatggacggaaatgggaggtgggcaaagatg |
29732484 |
T |
|
| Q |
198 |
agagggttgccgctgtcggagg |
219 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
29732483 |
agagggttgccgctgtcggagg |
29732462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 150 - 205
Target Start/End: Complemental strand, 29726892 - 29726837
Alignment:
| Q |
150 |
aagcatgtggcagtgattatggacggaaatgggaggtgggcaaagatgagagggtt |
205 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
29726892 |
aagcatgtggcggtgattatggacgggaatgggaggtgggcaaagatgagggggtt |
29726837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 136 - 210
Target Start/End: Complemental strand, 29747490 - 29747416
Alignment:
| Q |
136 |
aggagatgattccgaagcatgtggcagtgattatggacggaaatgggaggtgggcaaagatgagagggttgccgc |
210 |
Q |
| |
|
||||| |||| |||||||||||||| |||||||||| ||||| |||||||||| || |||||||||||||||| |
|
|
| T |
29747490 |
aggagctgatgccgaagcatgtggcgttgattatggatggaaacaggaggtgggcgaaaatgagagggttgccgc |
29747416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University