View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2461_low_8 (Length: 245)
Name: NF2461_low_8
Description: NF2461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2461_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 21 - 222
Target Start/End: Original strand, 32132341 - 32132542
Alignment:
| Q |
21 |
aataaccagaggaaaaaggattttggttttggaacaaggaaaacaaatgaaaaatttatttgtatttgtatatatgaaaatgaaaaatgtactcacccaa |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
32132341 |
aataaccagaggaaaaaggattttggttttggaacaaggaaaacaaatgaaaaatttatttgtatttgtatatatgaaaatgaaaaatatactcacccaa |
32132440 |
T |
 |
| Q |
121 |
cccaatgtctccttttttataagatcatttttatttataattgcattaattatttatctatcttgtctaataagtacagtaagccacgagacaatattat |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||| ||||| || |||||||||||| |
|
|
| T |
32132441 |
cccaatgtctccttttttataagatcatttttatttataattgcattaattatttatctatcttgtctgataagcacaataagctacaagacaatattat |
32132540 |
T |
 |
| Q |
221 |
gc |
222 |
Q |
| |
|
|| |
|
|
| T |
32132541 |
gc |
32132542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University