View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2462_low_12 (Length: 278)
Name: NF2462_low_12
Description: NF2462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2462_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 50 - 240
Target Start/End: Original strand, 53664980 - 53665170
Alignment:
| Q |
50 |
tttgaaggtacctagtgggaagacgatagaaatgcgcccaaagatcatcctcaaaaccgggagccataatctcaggaacattcaattccctaagtcgact |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53664980 |
tttgaaggtacctagtgggaagacgatagaaatgcgcccaaagatcatcctcaaaaccgggagccataatctcaggaacattcaattccctaagtcgact |
53665079 |
T |
 |
| Q |
150 |
aagaactttgaggtaaacttcaatcttttgtttctgctttccattttgattccattcagaactgacaactttgatattacaacaactctct |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||| |||||||||||| |
|
|
| T |
53665080 |
aagaactttgaggtaaacttcaatcttttgtttctgctttccattttgattccattcagaactgatagctttgatattgcaacaactctct |
53665170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University