View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2462_low_26 (Length: 202)
Name: NF2462_low_26
Description: NF2462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2462_low_26 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 120; Significance: 1e-61; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 31 - 197
Target Start/End: Complemental strand, 981046 - 980880
Alignment:
| Q |
31 |
caaaggagggcgtacgaaatggtttgttctaatgtg-agaatcatattttggttgtatttttgcaaatttagtttcaggttacctaccatactataactt |
129 |
Q |
| |
|
||||||||||| |||||||||||| |||| |||||| | |||||||||||||| |||||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
981046 |
caaaggagggcatacgaaatggtt-gttccaatgtgtaaaatcatattttggtagtatttttgcaaatttagtttcaggttacctatcatactctaactt |
980948 |
T |
|
| Q |
130 |
tttctttgctttaacataatgtgataggagacagatttgagaagacccatttgtcgagctgaggttat |
197 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
980947 |
tttctttgctttaacataatatgataggagacagaattgagaagacccatttgtcgagctgaggttat |
980880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University