View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2462_low_9 (Length: 321)
Name: NF2462_low_9
Description: NF2462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2462_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 98 - 233
Target Start/End: Original strand, 27804844 - 27804980
Alignment:
| Q |
98 |
acatagttattacttagtaagattattattctttgtagacatatgtattttt-gtaagcgtagttttgttgaacggatatgaggtcatttacatgaagat |
196 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27804844 |
acatagttagtacttagtaagattattattctttatagacatatgtatttttagtaagcgtagttttgttgaacggatatgaggtcatttacatgaagat |
27804943 |
T |
|
| Q |
197 |
ccgacctcttgtaccacttcgtaagatatagctaagg |
233 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |
|
|
| T |
27804944 |
ccgacctcctgtaccacttcgtaagatatagctaagg |
27804980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University