View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2465_low_11 (Length: 353)
Name: NF2465_low_11
Description: NF2465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2465_low_11 |
 |  |
|
| [»] scaffold0332 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0332 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: scaffold0332
Description:
Target: scaffold0332; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 95 - 338
Target Start/End: Complemental strand, 11108 - 10865
Alignment:
| Q |
95 |
tttcattttctttttcgtacattcacacaacaaacaagtattaagaacataatacactatgcagcaccgatacttctgatcgaaagtgaatcaggtatcc |
194 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11108 |
tttcattttctttttcgtagattcacacaacaaacaagtattaagaacataatacactatgcagcaccgatacttctgatcgaaagtgaatcaggtatcc |
11009 |
T |
 |
| Q |
195 |
gacactgacaactcagttattctactctcaaattaccaccagagtcattctcaaattactaccagtgtcagatgtcttagtatcatgtccagtgtaagtg |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11008 |
gacactgacaactcagttattctactctcaaattaccaccagagtcattctcaaattactaccagtgtcagatgtcttagtatcatgtccagtgtaagtg |
10909 |
T |
 |
| Q |
295 |
ccagtacttcgtaagattatacaccatctattcccaaactattc |
338 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
10908 |
ccagtacttcataagattatacaccatctatccccaaactattc |
10865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0332; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 6 - 55
Target Start/End: Complemental strand, 11200 - 11151
Alignment:
| Q |
6 |
gtccaataatattgccagcatatcagaggcacaacagctaaagtaaagag |
55 |
Q |
| |
|
|||||| || |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11200 |
gtccaacaaaattgccagcatatcagaggcacaacagctaaagtaaagag |
11151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University